Top » Catalog » SNPs » A120

$19.00

A120
[A120]

A120
hg38 Position: ChrY:8523646..8523646
Ancestral: T
Derived: G
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l1~
Comments: Found in a R1b-FGC5496 person
Forward Primer: A120_F GTGGTTCTTGGCTATGGGTC
Reverse Primer: A120_R CCTTAGAATGGGGCAGCTC
Reviews

Customers who bought this product also purchased
A128
A128
A133
A133
A139
A139
A127
A127
A132
A132
A138
A138
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies