Top » Catalog » SNPs » A761

$18.00

A761
[A761]

A761
hg38 Position: ChrY:11370651..11370651
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a2a
Comments: Found in CTS4466 individuals below A195
Forward Primer: A761_F GGGCATGGCTTAGTTGTATGT
Reverse Primer: A761_R AAATGAATTTTATAATCAGCATTTCATG
Reviews

Customers who bought this product also purchased
A12594
A12594
A11843
A11843
Y878
Y878
R1b-A761 Panel
R1b-A761 Panel
A12592
A12592
A12591
A12591
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies