Top » Catalog » SNPs » Z56

$18.00

Z56
[Z56]

Z56
hg38 Position: ChrY:16736275..16736275
Ancestral: G
Derived: A
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a2b3
Comments: downstream of R-Z42. Z43
Forward Primer: Z56_F TCTCCTGAGTATAGCACACCAATAAG
Reverse Primer: Z56_R TGTTAAGATAATCCAGGGAGAAAAGTAG
Reviews

Customers who bought this product also purchased
DYS390
DYS390
YSEQ-Alpha
YSEQ-Alpha
PF6577
PF6577
L513
L513
DF49
DF49
Z16500
Z16500
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies