Top » Catalog » SNPs » Z56

$18.00

Z56
[Z56]

Z56
hg38 Position: ChrY:16736275..16736275
Ancestral: G
Derived: A
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a2b3
Comments: downstream of R-Z42. Z43
Forward Primer: Z56_F TCTCCTGAGTATAGCACACCAATAAG
Reverse Primer: Z56_R TGTTAAGATAATCCAGGGAGAAAAGTAG
Reviews

Customers who bought this product also purchased
SK2076
SK2076
PF7563
PF7563
BY177884
BY177884
Y140068
Y140068
BY3851
BY3851
Y32760
Y32760
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies