Top » Catalog » SNPs » Z56

$18.00

Z56
[Z56]

Z56
hg38 Position: ChrY:16736275..16736275
Ancestral: G
Derived: A
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a2b3
Comments: downstream of R-Z42. Z43
Forward Primer: Z56_F TCTCCTGAGTATAGCACACCAATAAG
Reverse Primer: Z56_R TGTTAAGATAATCCAGGGAGAAAAGTAG
Reviews

Customers who bought this product also purchased
DF27
DF27
DF49
DF49
L238
L238
DF19
DF19
FGC4166
FGC4166
FGC36261
FGC36261
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies