Top » Catalog » SNPs » Z56

$18.00

Z56
[Z56]

Z56
HG19 Position: ChrY:18848155..18848155
Ancestral: G
Derived: A
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a2a1a2b3
Comments: downstream of R-Z42, Z43
Forward Primer: Z56_F TCTCCTGAGTATAGCACACCAATAAG
Reverse Primer: Z56_R TGTTAAGATAATCCAGGGAGAAAAGTAG
Reviews

Customers who bought this product also purchased
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
CTS4705
CTS4705
CTS10851
CTS10851
S1051
S1051
BY2806
BY2806
Z39589
Z39589
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies