Top » Catalog » SNPs » Z56

$18.00

Z56
[Z56]

Z56
hg38 Position: ChrY:16736275..16736275
Ancestral: G
Derived: A
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a2b3
Comments: downstream of R-Z42. Z43
Forward Primer: Z56_F TCTCCTGAGTATAGCACACCAATAAG
Reverse Primer: Z56_R TGTTAAGATAATCCAGGGAGAAAAGTAG
Reviews

Customers who bought this product also purchased
CTS8149
CTS8149
CTS10222
CTS10222
Z67
Z67
CTS10270
CTS10270
Y16885
Y16885
A7969
A7969
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies