Top » Catalog » SNPs » Z56

$18.00

Z56
[Z56]

Z56
HG19 Position: ChrY:18848155..18848155
Ancestral: G
Derived: A
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a2a1a2b3
Comments: downstream of R-Z42, Z43
Forward Primer: Z56_F TCTCCTGAGTATAGCACACCAATAAG
Reverse Primer: Z56_R TGTTAAGATAATCCAGGGAGAAAAGTAG
Reviews

Customers who bought this product also purchased
S1523
S1523
R1b-L21 Super-Clade Orientation Panel
R1b-L21 Super-Clade Orientation Panel
CTS4705
CTS4705
CTS10851
CTS10851
S1051
S1051
BY3958
BY3958
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies