Top » Catalog » SNPs » Z56

$18.00

Z56
[Z56]

Z56
HG19 Position: ChrY:16736275..16736275
Ancestral: G
Derived: A
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a2b3
Comments: downstream of R-Z42. Z43
Forward Primer: Z56_F TCTCCTGAGTATAGCACACCAATAAG
Reverse Primer: Z56_R TGTTAAGATAATCCAGGGAGAAAAGTAG
Reviews

Customers who bought this product also purchased
A7993
A7993
Y17172
Y17172
CTS5531
CTS5531
PH2997
PH2997
Y17163
Y17163
A7969
A7969
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies