Top » Catalog » SNPs » A136

$19.00

A136
[A136]

A136
hg38 Position: ChrY:15883660..15883660
Ancestral: C
Derived: A
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l1~
Comments: Found in a R1b-FGC5496 person
Forward Primer: A136v2_F CAGAATATACATCTCAATTAACACTTCAG
Reverse Primer: A136v2_R TTTGACTATGTTGTATACGTCTCATCTAG
Reviews

Customers who bought this product also purchased
A121
A121
S2202
S2202
A130
A130
A137
A137
A120
A120
A144
A144
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies