Top » Catalog » SNPs » A1774

$19.00

A1774
[A1774]

A1774
hg38 Position: ChrY:15555656..15555656
Ancestral: A
Derived: T
Reference: Iain Kennedy (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Branch below R1b-A224
Forward Primer: A1774_F TCCTTTAAGCAACTATTTATTGGTCTG
Reverse Primer: A1774_R GGCTGAACACTGGCACTGA
Reviews

Customers who bought this product also purchased
A1775
A1775
A22792
A22792
A822
A822
FGC32899
FGC32899
A223
A223
A22790
A22790
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies