Top » Catalog » SNPs » A1775

$18.00

A1775
[A1775]

A1775
hg38 Position: ChrY:16613961..16613961
Ancestral: T
Derived: C
Reference: Iain Kennedy (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Branch below R1b-A224
Forward Primer: A1775_F AAGGGGTTTAAATTCCTCACTACAC
Reverse Primer: A1775_R CTCAGTGCTTGGCACCAAC
Reviews

Customers who bought this product also purchased
A984
A984
A738
A738
A10528
A10528
ZS8379
ZS8379
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
BY18130
BY18130
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies