Top » Catalog » SNPs » FGC8712

$18.00

FGC8712
[FGC8712]

FGC8712
hg38 Position: ChrY:15272075..15272075
Ancestral: G
Derived: A
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Aka Y6074. approx. Y4349
Forward Primer: FGC8712_F CCAACATGGTGAAACTGCC
Reverse Primer: FGC8712_R AGCATGACATTCTGTGACTGC
Reviews

Customers who bought this product also purchased
BY198122
BY198122
CTS8308
CTS8308
FGC3718
FGC3718
B237
B237
CTS10177
CTS10177
Z18258
Z18258
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies