Top » Catalog » SNPs » FGC8712

$18.00

FGC8712
[FGC8712]

FGC8712
hg38 Position: ChrY:15272075..15272075
Ancestral: G
Derived: A
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Aka Y6074. approx. Y4349
Forward Primer: FGC8712_F CCAACATGGTGAAACTGCC
Reverse Primer: FGC8712_R AGCATGACATTCTGTGACTGC
Reviews (1)

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
Wish a SNP
Wish a SNP
ZS10833
ZS10833
S21237
S21237
BY198122
BY198122
FGC86271
FGC86271
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies