Top » Catalog » SNPs » FGC8712

$18.00

FGC8712
[FGC8712]

FGC8712
hg38 Position: ChrY:15272075..15272075
Ancestral: G
Derived: A
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Aka Y6074. approx. Y4349
Forward Primer: FGC8712_F CCAACATGGTGAAACTGCC
Reverse Primer: FGC8712_R AGCATGACATTCTGTGACTGC
Reviews

Customers who bought this product also purchased
FGC5
FGC5
ZS10829
ZS10829
J1-M267 Superclade Panel
J1-M267 Superclade Panel
ZS5871
ZS5871
FGC9587
FGC9587
L858
L858
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies