Top » Catalog » SNPs » FGC8712

$18.00

FGC8712
[FGC8712]

FGC8712
HG19 Position: ChrY:17383955..17383955
Ancestral: G
Derived: A
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Aka Y6074, approx. Y4349
Forward Primer: FGC8712_F CCAACATGGTGAAACTGCC
Reverse Primer: FGC8712_R AGCATGACATTCTGTGACTGC
Reviews

Customers who bought this product also purchased
YSEQ-Alpha
YSEQ-Alpha
FGC8703
FGC8703
FGC30416
FGC30416
FGC10500
FGC10500
FGC12
FGC12
L859
L859
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies