Top » Catalog » SNPs » FGC10500

$18.00

FGC10500
[FGC10500]

FGC10500
hg38 Position: ChrY:20706147..20706147
Ancestral: T
Derived: C
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: .
Forward Primer: FGC10500_F ATAAACAAACCAACAACAAATAGTGAC
Reverse Primer: FGC10500_R GTGCATTCTTACCCATCTTGG
Reviews

Customers who bought this product also purchased
M267
M267
FGC30566
FGC30566
FGC9589
FGC9589
FGC9581
FGC9581
ZS5871
ZS5871
FGC9587
FGC9587
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies