Top » Catalog » SNPs » FGC10500

$18.00

FGC10500
[FGC10500]

FGC10500
hg38 Position: ChrY:20706147..20706147
Ancestral: T
Derived: C
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: .
Forward Primer: FGC10500_F ATAAACAAACCAACAACAAATAGTGAC
Reverse Primer: FGC10500_R GTGCATTCTTACCCATCTTGG
Reviews

Customers who bought this product also purchased
FT239596
FT239596
BY50476
BY50476
S21237
S21237
Wish a SNP
Wish a SNP
ZS10833
ZS10833
FGC3723
FGC3723
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
2 x A18999
2 x B33
3 x A15392
3 x A19016
3 x BY126888
2 x S15560
2 x BY38200
$306.00
Haplogroup Info
Other products
Currencies