Top » Catalog » SNPs » FGC10500

$18.00

FGC10500
[FGC10500]

FGC10500
hg38 Position: ChrY:20706147..20706147
Ancestral: T
Derived: C
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: .
Forward Primer: FGC10500_F ATAAACAAACCAACAACAAATAGTGAC
Reverse Primer: FGC10500_R GTGCATTCTTACCCATCTTGG
Reviews

Customers who bought this product also purchased
BY72
BY72
FGC54316
FGC54316
ZS2167
ZS2167
FT270703
FT270703
Z18243
Z18243
BY193404
BY193404
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies