Top » Catalog » SNPs » FGC10500

$18.00

FGC10500
[FGC10500]

FGC10500
hg38 Position: ChrY:20706147..20706147
Ancestral: T
Derived: C
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: .
Forward Primer: FGC10500_F ATAAACAAACCAACAACAAATAGTGAC
Reverse Primer: FGC10500_R GTGCATTCTTACCCATCTTGG
Reviews

Customers who bought this product also purchased
M267
M267
FGC9589
FGC9589
FGC9581
FGC9581
FGC30566
FGC30566
L858
L858
FGC1713
FGC1713
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x L829
$18.00
Haplogroup Info
Other products
Currencies