Top » Catalog » SNPs » FGC10500

$18.00

FGC10500
[FGC10500]

FGC10500
hg38 Position: ChrY:20706147..20706147
Ancestral: T
Derived: C
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: .
Forward Primer: FGC10500_F ATAAACAAACCAACAACAAATAGTGAC
Reverse Primer: FGC10500_R GTGCATTCTTACCCATCTTGG
Reviews

Customers who bought this product also purchased
FGC67360
FGC67360
FGC9581
FGC9581
DYS513
DYS513
FGC38790
FGC38790
FT239596
FT239596
BY50476
BY50476
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies