Top » Catalog » SNPs » FGC10500

$18.00

FGC10500
[FGC10500]

FGC10500
hg38 Position: ChrY:20706147..20706147
Ancestral: T
Derived: C
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: .
Forward Primer: FGC10500_F ATAAACAAACCAACAACAAATAGTGAC
Reverse Primer: FGC10500_R GTGCATTCTTACCCATCTTGG
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
BY8
BY8
YSEQ-Beta
YSEQ-Beta
YSEQ-Alpha-Beta
YSEQ-Alpha-Beta
FGC9585
FGC9585
ZS2094
ZS2094
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies