Top » Catalog » SNPs » FGC8703

$18.00

FGC8703
[FGC8703]

FGC8703
HG19 Position: ChrY:7523736..7523736
Ancestral: A
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: .
Forward Primer: FGC8703_F TTTGCAAAAGTCTGAAATGCAG
Reverse Primer: FGC8703_R CTGGAATGCAGTGGTGCA
Reviews

Customers who bought this product also purchased
FGC8712
FGC8712
YSEQ-Alpha
YSEQ-Alpha
L859
L859
FGC30416
FGC30416
CTS8308
CTS8308
FGC10500
FGC10500
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies