Top » Catalog » SNPs » A1777

$18.00

A1777
[A1777]

A1777
hg38 Position: ChrY:13045319..13045319
Ancestral: T
Derived: C
Reference: Atanas Kumbarov (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Under CTS9219 parallel to BY250 and Y5587
Forward Primer: A1777_F TTCCCCATAGCAACTGGAAG
Reverse Primer: A1777_R TCAACTTGAACATTATTGCTGTACC
Reviews (1)

Customers who bought this product also purchased
BY63033
BY63033
FT49932
FT49932
L145
L145
P38
P38
M173
M173
*TOP* - Top-Level Orientation SNP Panel
*TOP* - Top-Level Orientation SNP Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies