Top » Catalog » SNPs » A1778

$19.00

A1778
[A1778]

A1778
hg38 Position: ChrY:8594812..8594812
Ancestral: ins
Derived: del
Reference: Bruce Cockburn (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below S5750
Forward Primer: A1778_F CTTTCACATTAAACATTTGCCTTG
Reverse Primer: A1778_R CCAGTCCCCACATTGAGAAC
Reviews

Customers who bought this product also purchased
S5750
S5750
A1781
A1781
A1779
A1779
A1785
A1785
A1784
A1784
A1783
A1783
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies