Top » Catalog » SNPs » A1785

$18.00

A1785
[A1785]

A1785
hg38 Position: ChrY:19095060..19095060
Ancestral: A
Derived: G
Reference: Bruce Cockburn (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A1785_F AGCCCAAACAAGGATATCAATG
Reverse Primer: A1785_R CACTTCCCATTCCAGCTGTC
Reviews

Customers who bought this product also purchased
A1781
A1781
A1779
A1779
A1778
A1778
A1784
A1784
A1783
A1783
A1782
A1782
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies