Top » Catalog » SNPs » Z1297

$18.00

Z1297
[Z1297]

Z1297
hg38 Position: ChrY:19329026..19329026
Ancestral: T
Derived: A
Reference: http://dna-forums.org (B. Schrack 2011)
ISOGG Haplogroup: J2b2a1a1a1a
Comments: Downstream of L283. upstream of Z631-Z639
Forward Primer: Z1297_F TCTCCACCACATGGAGAATC
Reverse Primer: Z1297_R TCCCTCCCCGTGTTTATATG
Reviews

Customers who bought this product also purchased
Y21045
Y21045
S23613
S23613
M172
M172
Y30088
Y30088
Y30676
Y30676
A31878
A31878
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies