Top » Catalog » SNPs » FGC29783

$18.00

FGC29783
[FGC29783]

FGC29783
hg38 Position: ChrY:7843156..7843156
Ancestral: G
Derived: A
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments: Below M222 > F1265
Forward Primer: FGC29783_F CCTCAATTAAGTACAGGCAAGCT
Reverse Primer: FGC29783_R GGCCAGAACTTCCAACACTAC
Reviews

Customers who bought this product also purchased
S588
S588
S7814
S7814
S603
S603
F1265
F1265
R1b-F1265 downstream segregation panel
R1b-F1265 downstream segregation panel
FGC29788
FGC29788
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies