Top » Catalog » SNPs » FGC29783

$18.00

FGC29783
[FGC29783]

FGC29783
hg38 Position: ChrY:7843156..7843156
Ancestral: G
Derived: A
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments: Below M222 > F1265
Forward Primer: FGC29783_F CCTCAATTAAGTACAGGCAAGCT
Reverse Primer: FGC29783_R GGCCAGAACTTCCAACACTAC
Reviews

Customers who bought this product also purchased
S603
S603
S588
S588
S7814
S7814
F1265
F1265
FGC29785
FGC29785
FGC29790
FGC29790
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies