Top » Catalog » SNPs » FGC29784

$18.00

FGC29784
[FGC29784]

FGC29784
hg38 Position: ChrY:8020676..8020676
Ancestral: G
Derived: A
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments: Below M222 > F1265
Forward Primer: FGC29784_F GTATGGAACAAAGGGTAGAGTTACG
Reverse Primer: FGC29784_R AAGCTAGCAGTTAAAGGTGTGATG
Reviews

Customers who bought this product also purchased
FGC29792
FGC29792
FGC29787
FGC29787
FGC29786
FGC29786
FGC29785
FGC29785
FGC29790
FGC29790
FGC29783
FGC29783
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies