Top » Catalog » SNPs » FGC29788

$18.00

FGC29788
[FGC29788]

FGC29788
hg38 Position: ChrY:16065779..16065779
Ancestral: A
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments: Below M222 > F1265
Forward Primer: FGC29788_F TGAATAAGAGGTCGTGGAGAATAAC
Reverse Primer: FGC29788_R TTATTTTTCCTGCAGGTGAGC
Reviews

Customers who bought this product also purchased
FGC29792
FGC29792
FGC29786
FGC29786
FGC29785
FGC29785
FGC29784
FGC29784
FGC29790
FGC29790
FGC29783
FGC29783
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies