Top » Catalog » SNPs » FGC29788

$18.00

FGC29788
[FGC29788]

FGC29788
hg38 Position: ChrY:16065779..16065779
Ancestral: A
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments: Below M222 > F1265
Forward Primer: FGC29788_F TGAATAAGAGGTCGTGGAGAATAAC
Reverse Primer: FGC29788_R TTATTTTTCCTGCAGGTGAGC
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies