Top » Catalog » SNPs » FGC29789

$18.00

FGC29789
[FGC29789]

FGC29789
hg38 Position: ChrY:16885964..16885964
Ancestral: C
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments: Below M222 > F1265
Forward Primer: FGC29789_F CTTTCAACTCCAGTGGCTACG
Reverse Primer: FGC29789_R AAAATAACTTAGGGTATGGGAGAGTG
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies