Top » Catalog » SNPs » FGC29790

$18.00

FGC29790
[FGC29790]

FGC29790
hg38 Position: ChrY:22257567..22257567
Ancestral: A
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments: Below M222 > F1265
Forward Primer: FGC29790_F TGGAGAAGACCTTCAATTATCAATG
Reverse Primer: FGC29790_R GGAAGAAGCATACAAGTGTATACAGAC
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies