Top » Catalog » SNPs » FGC29790

$18.00

FGC29790
[FGC29790]

FGC29790
hg38 Position: ChrY:22257567..22257567
Ancestral: A
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments: Below M222 > F1265
Forward Primer: FGC29790_F TGGAGAAGACCTTCAATTATCAATG
Reverse Primer: FGC29790_R GGAAGAAGCATACAAGTGTATACAGAC
Reviews

Customers who bought this product also purchased
FGC29792
FGC29792
FGC29787
FGC29787
FGC29786
FGC29786
FGC29785
FGC29785
FGC29784
FGC29784
FGC29789
FGC29789
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies