Top » Catalog » SNPs » L24

$18.00

L24
[L24]

L24
hg38 Position: ChrY:12165822..12165822
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: J2a1h
Comments: .
Forward Primer: L24_F GAGAGAGAGACATTATATTTAGGGAAACAG
Reverse Primer: L24_R CTGAGGTCAAATCATACATGTTCCT
Reviews

Customers who bought this product also purchased
Y9329
Y9329
FT171954
FT171954
Y9347
Y9347
Y238096
Y238096
YSC0000246
YSC0000246
FGC23960
FGC23960
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies