Top » Catalog » SNPs » L24

$18.00

L24
[L24]

L24
hg38 Position: ChrY:12165822..12165822
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: J2a1h
Comments: .
Forward Primer: L24_F GAGAGAGAGACATTATATTTAGGGAAACAG
Reverse Primer: L24_R CTGAGGTCAAATCATACATGTTCCT
Reviews

Customers who bought this product also purchased
ZS7528
ZS7528
Z7553
Z7553
Z7503
Z7503
FGC15901
FGC15901
M9
M9
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies