Top » Catalog » SNPs » L25

$18.00

L25
[L25]

L25
hg38 Position: ChrY:17024942..17024942
Ancestral: T
Derived: C
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: J2a1h2
Comments: Downstream L24
Forward Primer: L25_F GAAAACCCAAAAACAAACAAAAATAC
Reverse Primer: L25_R TTAATGATTGTGTTCATTCGCTTC
Reviews

Customers who bought this product also purchased
Z467
Z467
CTS3818
CTS3818
CTS900
CTS900
M172
M172
J2a-M67 Panel
J2a-M67 Panel
Y3629
Y3629
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies