Top » Catalog » SNPs » L25

$18.00

L25
[L25]

L25
hg38 Position: ChrY:17024942..17024942
Ancestral: T
Derived: C
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: J2a1h2
Comments: Downstream L24
Forward Primer: L25_F GAAAACCCAAAAACAAACAAAAATAC
Reverse Primer: L25_R TTAATGATTGTGTTCATTCGCTTC
Reviews

Customers who bought this product also purchased
Y3629
Y3629
M168
M168
M67
M67
Y11202
Y11202
M267
M267
M3731
M3731
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies