Top » Catalog » SNPs » FGC29792

$18.00

FGC29792
[FGC29792]

FGC29792
hg38 Position: ChrY:12608733..12608733
Ancestral: ins
Derived: del
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments: Below M222 > F1265
Forward Primer: FGC29792_F GTTGCTGCTGGCTGGAGTA
Reverse Primer: FGC29792_R ACCACTTTTATTGTTGCCTTCC
Reviews

Customers who bought this product also purchased
FGC29787
FGC29787
FGC29786
FGC29786
FGC29784
FGC29784
FGC29790
FGC29790
FGC29788
FGC29788
FGC29789
FGC29789
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies