Top » Catalog » SNPs » YP683

$18.00

YP683
[YP683]

YP683
hg38 Position: ChrY:14089048..14089048
Ancestral: G
Derived: A
Reference: R1a community
ISOGG Haplogroup: R1a (not listed)
Comments: Below Z280 > Z92 > YP617 > YP569
Forward Primer: YP683_F CAACTTCCCCAGGATGGTC
Reverse Primer: YP683_R TGCACAGTCACATGATCAGC
Reviews

Customers who bought this product also purchased
YP6187
YP6187
YP1696
YP1696
BY182582
BY182582
Y58868
Y58868
YP1697
YP1697
Y93168
Y93168
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies