Top » Catalog » SNPs » A2071

$18.00

A2071
[A2071]

A2071
hg38 Position: ChrY:6996469..6996469
Ancestral: C
Derived: T
Reference: Bruce Cockburn (2015)
ISOGG Haplogroup: R1b1a2a1a1b1a1 (not listed)
Comments: Downstream L257
Forward Primer: A2071_F TCTTGGGTGCCAAGTGAAAC
Reverse Primer: A2071_R TGGAGTTTCCCTCTTGTTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies