Top » Catalog » SNPs » A2075

$19.00

A2075
[A2075]

A2075
hg38 Position: ChrY:13169392..13169392
Ancestral: G
Derived: A
Reference: Bruce Cockburn (2015)
ISOGG Haplogroup: R1b1a2a1a1b1a1 (not listed)
Comments: Downstream L257
Forward Primer: A2075_F TTTAAGAGGCCTTCAGTTTTTG
Reverse Primer: A2075_R CATGCTTGTGGAAGTACCTTTTAG
Reviews
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies