Top » Catalog » SNPs » A144

$18.00

A144
[A144]

A144
hg38 Position: ChrY:22266119..22266119
Ancestral: G
Derived: T
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l1~
Comments: Found in a R1b-FGC5496 person
Forward Primer: A144_F GAGTGGAGAGGTGATGCTTG
Reverse Primer: A144_R ACTCGGTTACCCCAGACCAG
Reviews

Customers who bought this product also purchased
A128
A128
A133
A133
A117
A117
A139
A139
A127
A127
A132
A132
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies