Top » Catalog » SNPs » Z2106

$18.00

Z2106
[Z2106]

Z2106
hg38 Position: ChrY:12092940..12092940
Ancestral: G
Derived: A
Reference: Gregory Magoon (2012)
ISOGG Haplogroup: R1b1a1a2a2c
Comments: Downstream of L150; parallel to L51
Forward Primer: Z2106_F GGAGGGAGGGAAGGAAAGTAC
Reverse Primer: Z2106_R AGCAAAGGGCTTGCAAACAC
Reviews

Customers who bought this product also purchased
P312
P312
Y19434
Y19434
R1b-M343 Orientation Panel
R1b-M343 Orientation Panel
M269
M269
Y18687
Y18687
M343
M343
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies