Top » Catalog » SNPs » Z2106

$18.00

Z2106
[Z2106]

Z2106
hg38 Position: ChrY:12092940..12092940
Ancestral: G
Derived: A
Reference: Gregory Magoon (2012)
ISOGG Haplogroup: R1b1a1a2a2c
Comments: Downstream of L150; parallel to L51
Forward Primer: Z2106_F GGAGGGAGGGAAGGAAAGTAC
Reverse Primer: Z2106_R AGCAAAGGGCTTGCAAACAC
Reviews

Customers who bought this product also purchased
Y19469
Y19469
A1777
A1777
Y15982
Y15982
Y5587
Y5587
BY250
BY250
CTS7556
CTS7556
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies