Top » Catalog » SNPs » Z2106

$18.00

Z2106
[Z2106]

Z2106
hg38 Position: ChrY:12092940..12092940
Ancestral: G
Derived: A
Reference: Gregory Magoon (2012)
ISOGG Haplogroup: R1b1a1a2a2c
Comments: Downstream of L150; parallel to L51
Forward Primer: Z2106_F GGAGGGAGGGAAGGAAAGTAC
Reverse Primer: Z2106_R AGCAAAGGGCTTGCAAACAC
Reviews

Customers who bought this product also purchased
BY169242
BY169242
Y90794
Y90794
Y18785
Y18785
PH655
PH655
PH3048
PH3048
BY35054
BY35054
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies