Top » Catalog » SNPs » Z2106

$18.00

Z2106
[Z2106]

Z2106
hg38 Position: ChrY:12092940..12092940
Ancestral: G
Derived: A
Reference: Gregory Magoon (2012)
ISOGG Haplogroup: R1b1a1a2a2c
Comments: Downstream of L150; parallel to L51
Forward Primer: Z2106_F GGAGGGAGGGAAGGAAAGTAC
Reverse Primer: Z2106_R AGCAAAGGGCTTGCAAACAC
Reviews

Customers who bought this product also purchased
YSEQ-Alpha
YSEQ-Alpha
Whole Genome Sequence
Whole Genome Sequence
Z245
Z245
L21
L21
DF19
DF19
Y113338
Y113338
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies