Top » Catalog » SNPs » Z2106

$19.00

Z2106
[Z2106]

Z2106
hg38 Position: ChrY:12092940..12092940
Ancestral: G
Derived: A
Reference: Gregory Magoon (2012)
ISOGG Haplogroup: R1b1a1a2a2c
Comments: Downstream of L150; parallel to L51
Forward Primer: Z2106_F GGAGGGAGGGAAGGAAAGTAC
Reverse Primer: Z2106_R AGCAAAGGGCTTGCAAACAC
Reviews

Customers who bought this product also purchased
Y4362
Y4362
PF7585
PF7585
PF6534
PF6534
PF7562
PF7562
Y82789
Y82789
Y164153
Y164153
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies