Top » Catalog » SNPs » FGC5544

$18.00

FGC5544
[FGC5544]

FGC5544
hg38 Position: ChrY:20043866..20043866
Ancestral: C
Derived: A
Reference: Full Genomes Inc. (2013)
ISOGG Haplogroup: R1b1a1a2a1a2c1~
Comments: Found in a R-DF13 person
Forward Primer: FGC5544_F TGCATCCACTCTCCAACAAG
Reverse Primer: FGC5544_R TTTATTCTGCACTCTGTCCTTTTC
Reviews

Customers who bought this product also purchased
FGC5530
FGC5530
FGC5539
FGC5539
R1b-FGC5496 downstream
R1b-FGC5496 downstream
FGC5554
FGC5554
FGC5511
FGC5511
FGC5524
FGC5524
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies