Top » Catalog » SNPs » M401

$18.00

M401
[M401]

M401
hg38 Position: ChrY:2877528..2877529
Ancestral: del
Derived: ins
Reference: Di Cristofaro et al. (2013)
ISOGG Haplogroup: C2b1c1
Comments: .
Forward Primer: M401_F TGTGACCCACGTGACCTTAC
Reverse Primer: M401_R CATGGCCAGGTAATTGTGTG
Reviews

Customers who bought this product also purchased
M48
M48
Y4541
Y4541
FGC29011
FGC29011
M532
M532
Y4580
Y4580
FGC16217
FGC16217
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies