Top » Catalog » SNPs » M401

$18.00

M401
[M401]

M401
hg38 Position: ChrY:2877528..2877529
Ancestral: del
Derived: ins
Reference: Di Cristofaro et al. (2013)
ISOGG Haplogroup: C2b1c1
Comments: .
Forward Primer: M401_F TGTGACCCACGTGACCTTAC
Reverse Primer: M401_R CATGGCCAGGTAATTGTGTG
Reviews

Customers who bought this product also purchased
FGC16217
FGC16217
M217
M217
F7264
F7264
ZQ31
ZQ31
C Superclade Panel
C Superclade Panel
F3770
F3770
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies