Top » Catalog » SNPs » FGC23212

$18.00

FGC23212
[FGC23212]

FGC23212
hg38 Position: ChrY:12966419..12966419
Ancestral: T
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC23212_F CAAGTGGTGATGTGAAGGACA
Reverse Primer: FGC23212_R TCACATTGCCTCTCTAAGAATGG
Reviews

Customers who bought this product also purchased
FGC13326
FGC13326
S15663
S15663
BY128969
BY128969
DF98
DF98
L1
L1
A993
A993
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies