Top » Catalog » SNPs » FGC23212

$18.00

FGC23212
[FGC23212]

FGC23212
hg38 Position: ChrY:12966419..12966419
Ancestral: T
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC23212_F CAAGTGGTGATGTGAAGGACA
Reverse Primer: FGC23212_R TCACATTGCCTCTCTAAGAATGG
Reviews

Customers who bought this product also purchased
A993
A993
Z301
Z301
FGC8410
FGC8410
FGC8383
FGC8383
Z381
Z381
S11515
S11515
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies