Top » Catalog » SNPs » FGC23212

$18.00

FGC23212
[FGC23212]

FGC23212
hg38 Position: ChrY:12966419..12966419
Ancestral: T
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC23212_F CAAGTGGTGATGTGAAGGACA
Reverse Primer: FGC23212_R TCACATTGCCTCTCTAAGAATGG
Reviews

Customers who bought this product also purchased
BY12505
BY12505
R1b-U106 Superclade Panel
R1b-U106 Superclade Panel
FGC13326
FGC13326
S15663
S15663
BY128969
BY128969
DF98
DF98
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies